Part:BBa_K2342006:Experience

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K2342006

Contents:

1. Biology and system

2. Small scale Production

2.1 Cultivation and Induction

2.2 Purification

2.3 SDS-Page of protein purification

3 Large Scale Production (Half liter batch)

3.1 Cultivations and Induction

3.2 Cell Lysis and Purification

3.4 SDS-Page of protein purification

4. Concentration process and SDS PAGE

5. Ulp1 enzyme digestion and SDS PAGE

6. MALDI-TOF Analysis

7. Antimicrobial activity

1. Biology and system

The part codes for the expression of DCD1L peptide along with SUMO fusion peptide in E.coli and His tag for purification. Dermcidin is a human antimicrobial peptide secreted specifically by sweat glands. Dermcidin, composed of 110 amino acids (aa), is proteolytically processed to form a 48 amino acid DCD1L peptide found in human sweat. It has no homology to other known antimicrobial peptides. DCD-1 interacts preferentially with negatively charged bacterial phospholipids. This phospholipid-dependent interaction is followed by the formation of oligomeric complexes and the insertion into the bacterial membrane, which results in ion channel formation and bacterial cell death. DCD-1(L) possesses an amphiphilic structure and is anionic with a net negative charge of -2 at physiological pH. Fusion with SUMO protein offers primary advantage of producing the DCD1L antimicrobial peptide in E.coli without killing the host. Further putative benefits includes increased solubility and stability of recombinant proteins over other fusion tags.

A steady, highly defined and SUMO protease Ulp1 for systematic fusion tag cleavage and recombinant protein purification was used in the project. We describe in detail about the part usage, working and validation in our project.

Promoter information

The pET28a(+) vector contains a T7lac promoter (TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTC) which consists of the T7 promoter and downstream of that there is the lac operator sequence. In addition, the vector contains the gene lacI, which encodes for the lac repressor (LacI) that binds to the lac operator. This promoter can be induced by isopropyl-β-D-thiogalactopyranoside (IPTG) (ref. Novagen pET System Manual: https://research.fhcrc.org/content/dam/stripe/hahn/methods/biochem/pet.pdf )

Sequencing results

The sequences of the cloned part was confirmed from sequencing results. All the bases of the cloned part were confirmed to be correct.

2. Small scale Production

2.1 Cultivation and Induction of protein expression

For small scale production, 3-4 colonies from the transformation plates were inoculated (the expression strain cells (https://www.neb.com/products/c2566-t7-express-competent-e-coli-high-efficiency) transformed with plasmids carrying the gene of interest) in 7 ml LB-kanamycin (50 μg/ml working concentration) and the cells were grown at +37 °C until the culture reached the OD600 value ~0,51. When finished growing the cells, the expression of the gene of interest was induced by adding a final concentration of 0,5 mM IPTG in the cultures and continued to grow at +37 °C shaking. After induction of protein expression the OD600 value of the culture was measured and the cells were observed to be growing normally. The production of our antimicrobial peptide had not interfered with the bacterial growth. Hence the Smt3 fusion protein system for producing the antimicrobial peptides in E. coli was working.

2.2 Purification

Then, 4h after induction, we pelleted the cells by centrifuging at 12000 x g for 1 minute and discarded the supernatant. Then resuspended the pellet in 100 μl of ThermoFisher Scientific B-PER Bacterial Protein Extraction Reagent (https://www.thermofisher.com/order/catalog/product/78248).

After equilibrating the Qiagen Ni-NTA spin columns with 600 μl of NPI-10 buffer (50 nM NaPi, 300 mM NaCl, pH 8,0) started the protein purification. Loaded the samples onto the spin columns and centrifuged at 1600 rpm for 5 minutes. Followed by Washing the columns with 600 μl of NPI-20 buffer (50 mM NaPi, 300 mM NaCl, 30 mM imidazole, pH 8,0). Eluted the proteins in 300 μl of NPI-500 buffer (50 mM NaPi, 300 mM NaCl, 250 mM imidazole, pH 8,0). Stored the used spin columns soaked in 0,1 M EDTA solution, at +4 °C. The samples from different flow throughs and elution were then analysed using SDS PAGE. 2.3 SDS-Page of protein purification

From the SDS gel image (Figure 4), the expression of the desired construct could be observed after 2 hours and 4 hours incubation. Further after purification process, our desired construct could be observed in lysate (lane 9) and eluate (lane 13) samples.

3 Large Scale Production (Half liter batch)

3.1 Cultivations and Induction

Large scale protein expression was started by inoculating 3-10 single colonies (of the expression strain cells transformed with plasmids carrying the gene of interest) in 25mL of LB medium with the 50ug/ml Kanamycin and Incubated at +30°C with shaking overnight. The next day we prewarmed 500 mL of LB medium to +37°C in a 2L Erlenmeyer flask and Added 50 ug/ml Kanamycin. Then inoculated 3-5 mL of the overnight grown preculture in 500 mL prewarmed LB. Flask was incubated at +37°C with shaking until OD600 value reached 0.6.

Protein expression was then induced with a final concentration of 0.5mM IPTG and Incubated the culture at +37°C for 4 hours. The culture was then transferred to a 1L sorvall centrifuge bottle and cells harvested by centrifuging at 5,000 x g for 10 minutes at +16°C. The Supernatant was discarded and resuspended the pellet in Buffer A (50mM NaPi, 300mM NaCl, pH 8.0) to obtain a final volume of ~35mL. Samples were taken at different stages as shown below for SDS analysis. We can see our protein of interest produced after 2 hours and 4 hour incubation and in the lysate.

3.2 Cell Lysis and Purification

The 35 ml sample with harvested cells was then lysed using Emulsiflex machine and was injected into the ÄKTA Machine for protein purification using His tag affinity method. During purification, flow-through and elution fractions (Figure 8) were collected on a well plate. Elution fractions were selected with the desired protein from the graph (Figure. 7), and ran elution fractions on SDS-PAGE. Fractions that contain the desired protein were pooled, frozen in liquid nitrogen and stored at -20°C.

3.3 SDS-Page of protein purification

After running the selected fractions on the gel, it could be seen that eluates D1, D1, A2, B2, C2, D2, A3, B3, C3 and D3 had our desired protein. Hence these were collected for further protein concentration and buffer exchange step and rest eluates were discarded.

4. Concentration process and SDS PAGE

After pooling of the eluates it is important to concentrate the peptide samples. The protein was diluted in 20 ml of Buffer B (50 mM NaPi, 300 mM NaCl, 250 mM imidazole, pH 8,0). So the samples were concentrated using Sartorious VIVA SPIN 20 ultrafilter (Membrane: 5000 MWCO PES) and the buffer was exchanged to 10 mM NaPi pH 7.4.

For concentrating the peptide, first filter was washed with Milli-Q (~20mL). Then columns were filled with 20mL of the protein sample and Centrifuge at 3,000 x g for 30-45 minutes at +4°C (approximately half of the sample will go through the filter). The remaining sample were mixed by pipetting up and down and the centrifugation repeated. Meanwhile flow-through fractions are collected and run on SDS-PAGE to verify that the filter is not leaking before discarding them.

When ~5 mL of the old buffer is left above the filter, the column was filled up to 20 mL with our new NaPi buffer. Centrifuged at 3,000 x g for ~1 hour at +4°C. Repeated the step above (filling up the column with the new buffer) twice (or such that the amount of old buffer left in the sample is sufficiently low). In the end the desired sample volume in the column is ~5mL. The protein samples are then collected and stored in liquid nitrogen at -20°C.

5. Ulp1 enzyme digestion and SDS PAGE

For digesting 6xHis-Smt3-DCD-1L with Ulp1 to obtain free DCD1L, 0.5μL of Ulp1 protease was added to 50μL of the purified protein (concentrated in e.g. NaPi buffer). The suitable digestion time was determined by incubating the protein with Ulp1 for different time points and running them on an SDS-PAGE. We can see that 10 mins of Incubation at RT is enough.

Undigested samples are highlighted with a white box: 6xHis-Smt3-DCD-1L 18.3kDa. The desired peptides after digestion are highlighted with a red box: DCD-1L 4.82kDa. The digested N-terminus containing the 6xHis-tag and the Smt3-tag (13.5kDa) is highlighted with black. Since the mass of DCD-1L peptide is very low, it was challenging to observe the corresponding bands on the SDS-PAGE gel. Instead, the band corresponding to the 6xHis-Smt3 part can be clearly observed from the gel.

6. MALDI-TOF Analysis

The sample after Ulp1 digestion was analysed using mass spec to identify DCD1L. We use matrix-assisted laser desorption/ionization-time of flight/time of flight (MALDI-TOF-TOF) mass spectrometer (UltrafleXtreamTM Bruker, Aalto department of biotechnology and chemical technology facilities, Espoo, Finland) equipped with a 200-Hz smart-beam 1 laser (337 nm, 4 ns pulse) to identify masses of proteins/peptides. Data collection was carried out by operating the instrument in positive ion mode controlled by the flex software packaged (FlexControl, FlexAnalysis). 5,000 laser shots were accumulated per each spectrum in MS modes. Protein Calibration Standard mixture I, II. The peak which is exactly half of our desired mass is due to the doubly-charged proteins/peptides. Since, the result is mass/charge ratio, when the charge is 2 we get half the mass as the result.

7. Antimicrobial activity Assay

Bacterial cultures were grown until the OD reached 0.05 with corresponding 1.4*10^8 CFU/ml. The samples were incubated at 37°C, shaking for 40 mins with the respective antimicrobial peptides Nisin, DCD1L and LL37 (concentration used: 100 ug/ml). After incubation, the OD of the cells were measured. It was observed that the OD values in all the three samples with LL37, Nisin and produced DCD1L dropped after 40 minutes indicating antimicrobial property of the peptides.

References

Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Mentjies, P., & Drummond, A. (2012). Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data.Bioinformatics, 28(12), 1647-1649.

Schittek, B., Hipfel, R., Sauer, B., Bauer, J., Kalbacher, H., Stevanovic, S., Schirle, M., Schroeder, K., Blin, N., Meier, F. and Rassner, G & Rassner, G. (2001). Dermcidin: a novel human antibiotic peptide secreted by sweat glands. Nature immunology, 2(12).

Marblestone, J. G., Edavettal, S. C., Lim, Y., Lim, P., Zuo, X., & Butt, T. R. (2006). Comparison of SUMO fusion technology with traditional gene fusion systems: Enhanced expression and solubility with SUMO. Protein Science : A Publication of the Protein Society, 15(1), 182–189.

User Reviews

UNIQe2fa6e8c6b5c657f-partinfo-00000000-QINU UNIQe2fa6e8c6b5c657f-partinfo-00000001-QINU